BMRB Entry 7315
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full, LACS
BMRB Entry DOI: doi:10.13018/BMR7315
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: The backbone chemical shifts of ribosomal protein L11 in the complex with rRNA and thiostrepton PubMed: 17292917
Deposition date: 2006-10-13 Original release date: 2007-05-04
Authors: Lee, Donghan; Wang, Yun-Xing
Citation: Lee, D.; Walsh, JD.; Yu, P.; Markus, MA.; Choli-Papadopoulou, T.; Schwieters, CD.; Krueger, S.; Draper, DE.; Wang, YX.. "The structure of free L11 and functional dyanamics of L11 in free, L11-rRNA(58nt) binary and L11-rRNA(58nt)-thiostrepton ternary complexes" J. Mol. Biol. 367, 1007-1022 (2007).
Assembly members:
L11, polymer, 147 residues, Formula weight is not available
RNA, polymer, 58 residues, Formula weight is not available
Thiostrepton antibiotic, polymer, . residues, Formula weight is not available
Natural source: Common Name: Thermus thermophilus Taxonomy ID: 274 Superkingdom: Bacteria Kingdom: not available Genus/species: Thermus thermophilus
Experimental source: Production method: recombinant technology
Entity Sequences (FASTA):
L11: MKKVVAVVKLQLPAGKATPA
PPVGPALGQHGANIMEFVKA
FNAATANMGDAIVPVEITIY
ADRSFTFVTKTPPASYLIRK
AAGLEKGAHKPGREKVGRIT
WEQVLEIAKQKMPDLNTTDL
EAAARMIAGSARSMGVEVVG
APEVKDA
RNA: GCCAGGAUGUUGGCUUAGAA
GCAGCCAUCAUUUAAAGAAA
GCGUAAUAGCUCACUGGU
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 263 |
| 15N chemical shifts | 135 |
| 1H chemical shifts | 135 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | L11 | 1 |
| 2 | RNA | 2 |
| 3 | Thiostrepton | 3 |
Entities:
Entity 1, L11 147 residues - Formula weight is not available
| 1 | MET | LYS | LYS | VAL | VAL | ALA | VAL | VAL | LYS | LEU | ||||
| 2 | GLN | LEU | PRO | ALA | GLY | LYS | ALA | THR | PRO | ALA | ||||
| 3 | PRO | PRO | VAL | GLY | PRO | ALA | LEU | GLY | GLN | HIS | ||||
| 4 | GLY | ALA | ASN | ILE | MET | GLU | PHE | VAL | LYS | ALA | ||||
| 5 | PHE | ASN | ALA | ALA | THR | ALA | ASN | MET | GLY | ASP | ||||
| 6 | ALA | ILE | VAL | PRO | VAL | GLU | ILE | THR | ILE | TYR | ||||
| 7 | ALA | ASP | ARG | SER | PHE | THR | PHE | VAL | THR | LYS | ||||
| 8 | THR | PRO | PRO | ALA | SER | TYR | LEU | ILE | ARG | LYS | ||||
| 9 | ALA | ALA | GLY | LEU | GLU | LYS | GLY | ALA | HIS | LYS | ||||
| 10 | PRO | GLY | ARG | GLU | LYS | VAL | GLY | ARG | ILE | THR | ||||
| 11 | TRP | GLU | GLN | VAL | LEU | GLU | ILE | ALA | LYS | GLN | ||||
| 12 | LYS | MET | PRO | ASP | LEU | ASN | THR | THR | ASP | LEU | ||||
| 13 | GLU | ALA | ALA | ALA | ARG | MET | ILE | ALA | GLY | SER | ||||
| 14 | ALA | ARG | SER | MET | GLY | VAL | GLU | VAL | VAL | GLY | ||||
| 15 | ALA | PRO | GLU | VAL | LYS | ASP | ALA |
Entity 2, RNA 58 residues - Formula weight is not available
| 1 | G | C | C | A | G | G | A | U | G | U | ||||
| 2 | U | G | G | C | U | U | A | G | A | A | ||||
| 3 | G | C | A | G | C | C | A | U | C | A | ||||
| 4 | U | U | U | A | A | A | G | A | A | A | ||||
| 5 | G | C | G | U | A | A | U | A | G | C | ||||
| 6 | U | C | A | C | U | G | G | U |
Entity 3, Thiostrepton - Formula weight is not available
Samples:
sample_1: L11, [U-13C; U-15N; U-2H], 0.7 mM; RNA mM; Thiostrepton mM
conditions_1: pH: 6.5; temperature: 308 K
Experiments:
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 1D [15N,1H]-TRACT | sample_1 | not available | conditions_1 |
| 3D TROSY-HNCA | sample_1 | not available | conditions_1 |
| 3D TROSY-HNCACB | sample_1 | not available | conditions_1 |
| 3D aromatic TROSY-hCCH COSY | sample_1 | not available | conditions_1 |
| 3D 15N-resolved NOESY | sample_1 | not available | conditions_1 |
| 3D 13C-resolved NOESY (aromatic carbon) | sample_1 | not available | conditions_1 |
Software:
No software information available
NMR spectrometers:
- Bruker Avance 600 MHz
- Varian INOVA 800 MHz
Related Database Links:
Download simulated HSQC data in one of the following formats:
CSV: Backbone
or all simulated shifts
SPARKY: Backbone
or all simulated shifts