BMRB Entry 6814
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR6814
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Class I GTP aptamer PubMed: 16510427
Deposition date: 2005-09-09 Original release date: 2007-07-16
Authors: Carothers, J.; Davis, J.; Chou, J.; Szostak, J.
Citation: Carothers, J.; Davis, J.; Chou, J.; Szostak, J.. "Solution structure of an informationally complex high-affinity RNA aptamer to GTP" RNA 12, 567-579 (2006).
Assembly members:
Class I RNA aptamer to GTP, polymer, 41 residues, Formula weight is not available
GTP, non-polymer, 523.180 Da.
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
Class I RNA aptamer to GTP: GGGACGAAGUGGUUGGGCGC
UUCGGCGUGUGAAAACGUCU
C
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 295 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | Class I RNA aptamer to GTP | 1 |
| 2 | GUANOSINE-5'-TRIPHOSPHATE | 2 |
Entities:
Entity 1, Class I RNA aptamer to GTP 41 residues - Formula weight is not available
| 1 | G | G | G | A | C | G | A | A | G | U | ||||
| 2 | G | G | U | U | G | G | G | C | G | C | ||||
| 3 | U | U | C | G | G | C | G | U | G | U | ||||
| 4 | G | A | A | A | A | C | G | U | C | U | ||||
| 5 | C |
Entity 2, GUANOSINE-5'-TRIPHOSPHATE - C10 H16 N5 O14 P3 - 523.180 Da.
| 1 | GTP |
Samples:
sample_1: Class I RNA aptamer to GTP, [U-15N; U-13C], 3.3 mM; GUANOSINE-5'-TRIPHOSPHATE 3.63 mM; phosphate buffer 10%; D2O 99%
sample_2: Class I RNA aptamer to GTP, [U-15N; U-13C], 0.9 mM; GUANOSINE-5'-TRIPHOSPHATE 0.99 mM; phosphate buffer 10%; D2O 99%
sample_3: Class I RNA aptamer to GTP, [U-15N; U-13C], 3.3 mM; GUANOSINE-5'-TRIPHOSPHATE 3.63 mM; phosphate buffer 10%; D2O 5%; H2O 95%
sample_4: Class I RNA aptamer to GTP, [U-15N; U-13C], 0.9 mM; GUANOSINE-5'-TRIPHOSPHATE 0.99 mM; phosphate buffer 10%; D2O 5%; H2O 95%
sample_cond_1: ionic strength: 80 mM; pH: 6.1; pressure: 1 atm; temperature: 288 K
sample_cond_2: ionic strength: 80 mM; pH: 6.1; pressure: 1 atm; temperature: 303 K
sample_cond_3: ionic strength: 80 mM; pH: 6.1; pressure: 1 atm; temperature: 298 K
sample_cond_4: ionic strength: 80 mM; pH: 6.8; pressure: 1 atm; temperature: 303 K
Experiments:
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 3D 13C-separated NOESY | not available | not available | not available |
| 3D 15N-separated NOESY | not available | not available | not available |
| 2D NOESY | not available | not available | not available |
| DQF-COSY | not available | not available | not available |
| 2D 1H decoupled 13C-1H CT HSQC | not available | not available | not available |
| 2D 13C-1H CT-TROSY | not available | not available | not available |
Software:
NMRPipe v2.3 - processing
X-PLOR NIH v2.9.2 - structure solution, refinement
SPARKY v3 - data analysis
NMR spectrometers:
- Bruker AVANCE 500 MHz