BMRB Entry 30665
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30665
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: NMR assignment and RNA structure of 5' UTR region stem loop from West Nile Virus PubMed: 32807496
Deposition date: 2019-09-01 Original release date: 2020-08-18
Authors: Sharma, S.; Varani, G.
Citation: Sharma, S.; Varani, G.. "NMR structure of Dengue West Nile viruses stem-loop B: A key cis-acting element for flavivirus replication" Biochem. Biophys. Res. Commun. ., .-. (2020).
Assembly members:
entity_1, polymer, 37 residues, 11841.064 Da.
Natural source: Common Name: West Nile virus Taxonomy ID: 11082 Superkingdom: Viruses Kingdom: not available Genus/species: Flavivirus West Nile virus
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGUUUCUUAGCACGAAGAUC
UCGAUGUCUAAGAAACC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 215 |
| 15N chemical shifts | 13 |
| 1H chemical shifts | 277 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | entity_1 | 1 |
Entities:
Entity 1, entity_1 37 residues - 11841.064 Da.
| 1 | G | G | U | U | U | C | U | U | A | G | ||||
| 2 | C | A | C | G | A | A | G | A | U | C | ||||
| 3 | U | C | G | A | U | G | U | C | U | A | ||||
| 4 | A | G | A | A | A | C | C |
Samples:
sample_1: entity_1, [U-99% 13C; U-99% 15N], 0.5 ± 0.1 mM; sodium phosphate 20 mM
sample_conditions_1: ionic strength: 20 mM; pH: 6.0; pressure: 1 atm; temperature: 298 K
Experiments:
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-15N HSQC | sample_1 | isotropic | sample_conditions_1 |
| 2D NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H TOCSY | sample_1 | isotropic | sample_conditions_1 |
| 1H proton | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | sample_1 | isotropic | sample_conditions_1 |
Software:
X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement, structure calculation
Sparky, Goddard - chemical shift assignment, peak picking
NMR spectrometers:
- Bruker AVANCE II 600 MHz
- Bruker AVANCE II 800 MHz