BMRB Entry 30058
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30058
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium PubMed: 30182059
Deposition date: 2016-04-05 Original release date: 2017-05-04
Authors: Dvorkin, S.; Karsisiotis, A.; Webba da Silva, M.
Citation: Dvorkin, Scarlett; Karsisiotis, Andreas; Webba da Silva, Mateus. "Encoding canonical DNA quadruplex structure." Sci Adv 4, eaat3007-eaat3007 (2018).
Assembly members:
DNA (25-MER), polymer, 25 residues, 7978.100 Da.
Natural source: Common Name: not available Taxonomy ID: 32644 Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
DNA (25-MER): GGGGTTTGGGGTTTTGGGGA
AGGGG
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 256 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | entity_1 | 1 |
Entities:
Entity 1, entity_1 25 residues - 7978.100 Da.
| 1 | DG | DG | DG | DG | DT | DT | DT | DG | DG | DG | ||||
| 2 | DG | DT | DT | DT | DT | DG | DG | DG | DG | DA | ||||
| 3 | DA | DG | DG | DG | DG |
Samples:
sample_1: DNA (25-MER), none, 2 ± 0.2 mM; NaPi 20 mM; H2O 90%; D2O 10%
sample_conditions_1: ionic strength: 20 mM; pH: 6.8; pressure: 1 atm; temperature: 293.15 K
Experiments:
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D DQF-COSY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H TOCSY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-31P HSQC | sample_1 | isotropic | sample_conditions_1 |
Software:
Felix, Accelrys Software Inc. - chemical shift assignment
X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - structure calculation
NMR spectrometers:
- Varian VNMRS 500 MHz
- Bruker AvanceIII 900 MHz