BMRB Entry 25427
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR25427
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: DNA/RNA (28-MER)
Deposition date: 2015-01-14 Original release date: 2015-12-07
Authors: Schmidtke, Sina; Duchardt-Ferner, Elke; Ohlenschlaeger, Oliver; Gottstein, Daniel; Wohnert, Jens
Citation: Schmidtke, Sina; Duchardt-Ferner, Elke; Ohlenschlaeger, Oliver; Gottstein, Daniel; Wohnert, Jens. "What a difference an OH makes: conformational dynamics as the basis for ligand specificity of the neomycin sensing riboswitch" Angew. Chem. Int. Ed. Engl. ., .-..
Assembly members:
RNA_(27-MER), polymer, 27 residues, 3295.044 Da.
PAROMOMYCIN, non-polymer, 615.628 Da.
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: obtained from a collaborator Host organism: in vitro transcription
Entity Sequences (FASTA):
RNA_(27-MER): GGCUGCUUGUCCUUUAAUGG
UCCAGUC
| Data type | Count |
| 13C chemical shifts | 444 |
| 15N chemical shifts | 20 |
| 1H chemical shifts | 622 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | DNA/RNA (28-MER) | 1 |
| 2 | PAROMOMYCIN | 2 |
Entities:
Entity 1, DNA/RNA (28-MER) 27 residues - 3295.044 Da.
| 1 | G | G | C | U | G | C | U | U | G | U | ||||
| 2 | C | C | U | U | U | A | A | U | G | G | ||||
| 3 | U | C | C | A | G | U | C |
Entity 2, PAROMOMYCIN - C23 H45 N5 O14 - 615.628 Da.
| 1 | PAR |
Samples:
sample_1: RNA (27-MER) 0.64 mM; Paromomycin 0.64 mM; D2O 10%; H2O 90%
sample_2: RNA (27-MER), 13C; 15N, 0.89 mM; Paromomycin 0.89 mM; D2O 10%; H2O 90%
sample_3: RNA (27-MER), 13C; 15N, 0.89 mM; Paromomycin 0.89 mM; D2O 100%
sample_4: RNA (27-MER), G-]13C; 15N], 0.62 mM; Paromomycin 0.62 mM; D2O 100%
sample_conditions_1: pH: 6.2; pressure: 1 atm; temperature: 283 K
sample_conditions_2: pH: 6.2; pressure: 1 atm; temperature: 298 K
Experiments:
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-15N HSQC | sample_2 | isotropic | sample_conditions_1 |
| 2D 1H-13C HNCO | sample_2 | isotropic | sample_conditions_1 |
| 2D 1H-15N H56C56C4N3H | sample_2 | isotropic | sample_conditions_1 |
| 2D 1H-15N HSQC NH2 only | sample_2 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC aromatic | sample_3 | isotropic | sample_conditions_2 |
| 2D 1H-13C HSQC aliphatic | sample_3 | isotropic | sample_conditions_2 |
| 2D 1H-13C HSQC aliphatic | sample_4 | isotropic | sample_conditions_2 |
| 3D 1H-13C NOESY-HSQC aliphatic | sample_3 | isotropic | sample_conditions_2 |
| 3D 1H-13C NOESY-HMQC aromatic | sample_3 | isotropic | sample_conditions_2 |
| 3D HCCH-COSY | sample_3 | isotropic | sample_conditions_2 |
| 3D HCCH-TOCSY | sample_3 | isotropic | sample_conditions_2 |
| 2D 1H-15N lrHSQC | sample_3 | isotropic | sample_conditions_2 |
| 2D DQF-COSY | sample_3 | isotropic | sample_conditions_2 |
| 2D 1H-31P HCP | sample_3 | isotropic | sample_conditions_2 |
| 3D HCCH-TOCSY-E.COSY | sample_3 | isotropic | sample_conditions_2 |
| 2D 13C filter NOESY | sample_3 | isotropic | sample_conditions_2 |
| 2D 13C filter TOCSY | sample_3 | isotropic | sample_conditions_2 |
| 2D quant 31P coupled 1H, 13C HSQC | sample_3 | isotropic | sample_conditions_2 |
| 2D quant 31P coupled 1H-13C HMQC | sample_3 | isotropic | sample_conditions_2 |
Software:
TOPSPIN v2.1, Bruker Biospin - collection, processing
SPARKY, Goddard - chemical shift assignment, peak integration, peak picking
CYANA v2.1, Guntert, Mumenthaler and Wuthrich - structure solution
NMR spectrometers:
- Bruker DRX 600 MHz
- Bruker Avance 600 MHz
- Bruker Avance 700 MHz
- Bruker Avance 800 MHz
- Bruker Avance 900 MHz
- Bruker Avance 950 MHz