BMRB Entry 18902
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR18902
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution structure of the major G-quadruplex formed in the human VEGF promoter: Insights into loop interactions of the parallel G-quadruplexes PubMed: 24005038
Deposition date: 2012-12-14 Original release date: 2013-09-16
Authors: Agrawal, Prashansa; Hatzakis, Emmanuel; Guo, Kexiao; Carver, Megan; Yang, Danzhou
Citation: Agrawal, Prashansa; Hatzakis, Emmanuel; Guo, Kexiao; Carver, Megan; Yang, Danzhou. "Solution structure of the major G-quadruplex formed in the human VEGF promoter in K+: insights into loop interactions of the parallel G-quadruplexes." Nucleic Acids Res. 41, 10584-10592 (2013).
Assembly members:
major_G-quadruplex, polymer, 22 residues, 6922.468 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: recombinant technology
Entity Sequences (FASTA):
major_G-quadruplex: CGGGGCGGGCCTTGGGCGGG
GT
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 202 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | major_G-quadruplex | 1 |
Entities:
Entity 1, major_G-quadruplex 22 residues - 6922.468 Da.
| 1 | DC | DG | DG | DG | DG | DC | DG | DG | DG | DC | ||||
| 2 | DC | DT | DT | DG | DG | DG | DC | DG | DG | DG | ||||
| 3 | DG | DT |
Samples:
sample_1: major_G-quadruplex 0.2 mM; H2O 90%; D2O 10%
sample_conditions_1: ionic strength: 100 mM; pH: 7.0; pressure: 1 atm; temperature: 298 K
Experiments:
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H TOCSY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H COSY | sample_1 | isotropic | sample_conditions_1 |
Software:
X-PLOR NIH, Brunger - geometry optimization, refinement, structure solution
NMR spectrometers:
- Bruker Avance 600 MHz