BMRB Entry 17860
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR17860
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: high resolution NMR solution structure of helix H1 of the chimpanzee HAR1 RNA PubMed: 22961937
Deposition date: 2011-08-12 Original release date: 2012-07-24
Authors: Cevec, Mirko; Ziegeler, Melanie; Richter, Christian; Schwalbe, Harald
Citation: Ziegeler, Melanie; Cevec, Mirko; Richter, Christian; Schwalbe, Harald. "NMR Studies of HAR1 RNA Secondary Structures Reveal Conformational Dynamics in the Human RNA" Chembiochem 13, 2100-2112 (2012).
Assembly members:
RNA_(37-MER), polymer, 37 residues, 11872.162 Da.
Natural source: Common Name: chimpanzee Taxonomy ID: 9598 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Pan troglodytes
Experimental source: Production method: chemical synthesis Host organism: Escherichia coli
Entity Sequences (FASTA):
RNA_(37-MER): GGGUGAAAUGGAGGACUUCG
GUCCUCAAAUUUCACCC
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 282 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | RNA (37-MER) | 1 |
Entities:
Entity 1, RNA (37-MER) 37 residues - 11872.162 Da.
| 1 | G | G | G | U | G | A | A | A | U | G | ||||
| 2 | G | A | G | G | A | C | U | U | C | G | ||||
| 3 | G | U | C | C | U | C | A | A | A | U | ||||
| 4 | U | U | C | A | C | C | C |
Samples:
sample_1: RNA (37-MER) 0.6 mM; potassium chloride 50 mM; potassium phosphate 25 mM
sample_2: RNA (37-MER), [U-100% 15N], 0.4 mM; potassium chloride 50 mM; potassium phosphate 25 mM
sample_3: RNA (37-MER), [U-13C; U-15N]-Ade,Ura, 0.3 mM; potassium chloride 50 mM; potassium phosphate 25 mM
sample_4: RNA (37-MER), [U-13C; U-15N]-Cyt,Gua, 1 mM; potassium chloride 50 mM; potassium phosphate 25 mM
sample_5: RNA (37-MER), [U-13C; U-15N]-Cyt,Gua, 1 mM; potassium chloride 50 mM; potassium phosphate 25 mM
sample_conditions_1: ionic strength: 75 mM; pH: 6.2; pressure: 1 atm; temperature: 298 K
sample_conditions_2: ionic strength: 75 mM; pH: 6.2; pressure: 1 atm; temperature: 278 K
Experiments:
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-15N HSQC | sample_2 | isotropic | sample_conditions_2 |
| 2D HNN-COSY | sample_2 | isotropic | sample_conditions_2 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_2 |
| 3D 1H-13C-13C-TROSY relayed HCCH-COSY | sample_4 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | sample_5 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D DQF-COSY | sample_1 | isotropic | sample_conditions_1 |
| 3D 1H-13C NOESY | sample_5 | isotropic | sample_conditions_2 |
| 2D 1H-13C HCCNH-TOCSY | sample_3 | isotropic | sample_conditions_2 |
| 3D HCP | sample_5 | isotropic | sample_conditions_1 |
| 2D 1H-31P COSY | sample_5 | isotropic | sample_conditions_1 |
| 3D forward-directed HCC-TOCSY-CCH E.COSY | sample_5 | isotropic | sample_conditions_1 |
| 2D H(C)N | sample_5 | isotropic | sample_conditions_1 |
| 2D HNCO | sample_4 | isotropic | sample_conditions_2 |
| 3D HCCH-TOCSY | sample_5 | isotropic | sample_conditions_1 |
Software:
ARIA v1.2, Linge, O, . - refinement
TOPSPIN v2.1, Bruker Biospin - collection, processing
SPARKY v3.113, Goddard - data analysis
CNS v1.1, Brunger, Adams, Clore, Gros, Nilges and Read - refinement
NMR spectrometers:
- Bruker Avance 950 MHz
- Bruker Avance 900 MHz
- Bruker Avance 800 MHz
- Bruker Avance 700 MHz
- Bruker Avance 600 MHz