BMRB Entry 15257
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full, LACS
BMRB Entry DOI: doi:10.13018/BMR15257
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Structural basis of RsmA/CsrA RNA recognition: Structure of RsmE bound to the Shine-Dalgarno sequence of hcnA mRNA PubMed: 17704818
Deposition date: 2007-05-21 Original release date: 2007-09-12
Authors: Schubert, Mario; Lapouge, Karine; Duss, Olivier; Oberstrass, Florian; Jelesarov, Ilian; Haas, Dieter; Allain, Frederic
Citation: Schubert, Mario; Lapouge, Karine; Duss, Olivier; Oberstrass, Florian; Jelesarov, Ilian; Haas, Dieter; Allain, Frederic. "Molecular basis of messenger RNA recognition by the specific bacterial repressing clamp RsmA/CsrA." Nat. Struct. Mol. Biol. 14, 807-813 (2007).
Assembly members:
hncA_mRNA_SD_20mer, polymer, 20 residues, 6437.938 Da.
RsmE, polymer, 70 residues, 5851.832 Da.
Natural source: Common Name: not available Taxonomy ID: 294 Superkingdom: Bacteria Kingdom: not available Genus/species: Pseudomonas fluorescens
Experimental source: Production method: in vitro transcription Host organism: Pseudomonas fluorescens
Entity Sequences (FASTA):
hncA_mRNA_SD_20mer: GGGCUUCACGGAUGAAGCCC
RsmE: MLILTRKVGESINIGDDITI
TILGVSGQQVRIGINAPKDV
AVHREEIYQRIQAGLTAPDK
RETPHHHHHH
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 340 |
| 15N chemical shifts | 77 |
| 1H chemical shifts | 625 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | 20 mer, 1 | 1 |
| 2 | 20 mer, 2 | 1 |
| 3 | RsmE A | 2 |
| 4 | RsmE B | 2 |
Entities:
Entity 1, 20 mer, 1 20 residues - 6437.938 Da.
| 1 | G | G | G | C | U | U | C | A | C | G | |
| 2 | G | A | U | G | A | A | G | C | C | C |
Entity 2, RsmE A 70 residues - 5851.832 Da.
| 1 | MET | LEU | ILE | LEU | THR | ARG | LYS | VAL | GLY | GLU | |
| 2 | SER | ILE | ASN | ILE | GLY | ASP | ASP | ILE | THR | ILE | |
| 3 | THR | ILE | LEU | GLY | VAL | SER | GLY | GLN | GLN | VAL | |
| 4 | ARG | ILE | GLY | ILE | ASN | ALA | PRO | LYS | ASP | VAL | |
| 5 | ALA | VAL | HIS | ARG | GLU | GLU | ILE | TYR | GLN | ARG | |
| 6 | ILE | GLN | ALA | GLY | LEU | THR | ALA | PRO | ASP | LYS | |
| 7 | ARG | GLU | THR | PRO | HIS | HIS | HIS | HIS | HIS | HIS |
Samples:
sample_1: RsmE, [U-100% 15N], 1 mM; hncA_mRNA_SD_20mer 1 mM; H2O 97%; D2O 3%; NaCl 30 mM; K2HPO4 50 mM
sample_2: RsmE, [U-100% 13C; U-100% 15N], 1 mM; hncA_mRNA_SD_20mer 1 mM; D2O 100%; NaCl 30 mM; K2HPO4 50 mM
sample_3: RsmE, [U-100% 13C; U-100% 15N], 1 mM; hncA_mRNA_SD_20mer 1 mM; H2O 97%; D2O 3%; NaCl 30 mM; K2HPO4 50 mM
sample_4: RsmE, [U-100% 15N], 1 mM; hncA_mRNA_SD_20mer 1 mM; D2O 100%; NaCl 30 mM; K2HPO4 50 mM
sample_conditions_1: ionic strength: 0.18 M; pH: 7.2; pressure: 1 atm; temperature: 313.15 K
Experiments:
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-15N HSQC | sample_1 | isotropic | sample_conditions_1 |
| 3D 1H-15N NOESY | sample_1 | isotropic | sample_conditions_1 |
| 3D CBCA(CO)NH | sample_3 | isotropic | sample_conditions_1 |
| 3D HNCA | sample_3 | isotropic | sample_conditions_1 |
| 3D HNCACB | sample_3 | isotropic | sample_conditions_1 |
| 3D HNCO | sample_3 | isotropic | sample_conditions_1 |
| 2D 1H-1H TOCSY | sample_1 | isotropic | sample_conditions_1 |
| 3D H(CCO)NH | sample_3 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | sample_2 | isotropic | sample_conditions_1 |
| 3D 1H-13C NOESY | sample_3 | isotropic | sample_conditions_1 |
| 3D HN(CO)CA | sample_3 | isotropic | sample_conditions_1 |
Software:
AMBER v7.0, Case, Darden, Cheatham, III, Simmerling, Wang, Duke, Luo, ... and Koll - refinement
DYANA v3.02, Guntert, Braun and Wuthrich - geometry optimization
SPARKY, Goddard - chemical shift assignment, data analysis
CCP4, CCP4 Executuve Committee - rename chains, superpose ensemble
NMR spectrometers:
- Bruker DMX 500 MHz
- Bruker DMX 600 MHz
- Bruker DMX 750 MHz
- Bruker Avance 900 MHz
Related Database Links:
| BMRB | 19534 19544 19546 19547 19548 19549 |
| PDB | |
| DBJ | BAO61455 BAQ73744 BAQ80031 |
| GB | AAT27429 AAY91370 AEL31265 AGL83913 AIC19187 |
| REF | WP_007920550 WP_017337657 WP_045057924 WP_057444113 |
Download simulated HSQC data in one of the following formats:
CSV: Backbone
or all simulated shifts
SPARKY: Backbone
or all simulated shifts