BMRB Entry 4226
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR4226
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: The Lead-Dependent Ribozyme
Deposition date: 1998-08-19 Original release date: 1999-12-23
Authors: Hoogstraten, C.; Legault, P.; Pardi, A.
Citation: Legault, P.; Hoogstraten, C.; Metlitzky, E.; Pardi, A.. "Order, Dynamics, and Metal-Binding in the Lead-Dependent Ribozyme" J. Mol. Biol. 284, 325-335 (1998).
Assembly members:
lead-dependent ribozyme, polymer, 30 residues, Formula weight is not available
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: cell free synthesis
Entity Sequences (FASTA):
lead-dependent ribozyme: GCGACCGAGCCAGCGAAAGU
UGGGAGUCGC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 206 |
| 15N chemical shifts | 92 |
| 1H chemical shifts | 278 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | lead-dependent ribozyme | 1 |
Entities:
Entity 1, lead-dependent ribozyme 30 residues - Formula weight is not available
| 1 | G | C | G | A | C | C | G | A | G | C | |
| 2 | C | A | G | C | G | A | A | A | G | U | |
| 3 | U | G | G | G | A | G | U | C | G | C |
Samples:
sample_1: lead-dependent ribozyme, [U-99% 13C; U-99% 15N], 1.2 mM; sodium phosphate 10 mM; sodium chloride 100 mM; EDTA 0.2 mM
sample_cond_1: ionic strength: 0.1 M; pH*: 5.5; pressure: 1 atm; temperature: 298 K
Experiments:
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| NOESY | sample_1 | not available | sample_cond_1 |
| CPMG-NOESY | sample_1 | not available | sample_cond_1 |
| BD-NOESY | sample_1 | not available | sample_cond_1 |
| CBD-NOESY | sample_1 | not available | sample_cond_1 |
| NOESY-HSQC | sample_1 | not available | sample_cond_1 |
| CBD-NOESY-HSQC | sample_1 | not available | sample_cond_1 |
| HMQC-NOESY-HSQC | sample_1 | not available | sample_cond_1 |
| HCCH-E.COSY | sample_1 | not available | sample_cond_1 |
| directed HCC-TOCSY-CCH-E.COSY | sample_1 | not available | sample_cond_1 |
| spin-echo difference CT-HCCH-COSY | sample_1 | not available | sample_cond_1 |
Software:
FELIX v2.3.0, 95.0 - Data Processing
NMR spectrometers:
- Varian UnityPlus 500 MHz
- Varian UnityInova 600 MHz
- Bruker DMX 750 MHz