BMRB Entry 26024
Click here to enlarge.
            
                PDB ID: 
                
                
                Entry in NMR Restraints Grid
                Validation report in NRG-CING
            Chem Shift validation:  AVS_full
BMRB Entry DOI: doi:10.13018/BMR26024
MolProbity Validation Chart            
                    NMR-STAR file interactive viewer.
                    NMR-STAR v3 text file.
                    NMR-STAR v2.1 text file (deprecated)
                    XML gzip file.
                    RDF gzip file.
                    All files associated with the entry
                
Title: RNA Bulge Loop that Specifically Binds Metal Ions PubMed: 27631837
Deposition date: 2016-04-08 Original release date: 2016-09-22
Authors: Gu, Xiaobo; Schroeder, Susan
Citation: Gu, Xiaobo; Park, Sun-Young; Tonelli, Marco; Cornilescu, Gabriel; Xia, Tianbing; Zhong, Dongping; Schroeder, Susan. "NMR Structures and Dynamics in a Prohead RNA Loop that Binds Metal Ions" J. Phys. Chem. Lett. ., 3841-3846 (2016).
Assembly members:
RNA_(28-MER), polymer, 28 residues,   8970.434 Da.
Natural source: Common Name: bacteriophage Taxonomy ID: 38018 Superkingdom: Viruses Kingdom: not available Genus/species: not available unidentified phage
Experimental source: Production method: enzymatic semisynthesis Host organism: Transcription of RNA using T7 polymerase
Entity Sequences (FASTA):
RNA_(28-MER): GGACGUUAAAAGGCUUCGGC
CUACGUCC
- assigned_chemical_shifts
 
| Data type | Count | 
| 13C chemical shifts | 78 | 
| 15N chemical shifts | 11 | 
| 1H chemical shifts | 184 | 
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID | 
|---|---|---|
| 1 | RNA (28-MER) | 1 | 
Entities:
Entity 1, RNA (28-MER) 28 residues - 8970.434 Da.
| 1 | G | G | A | C | G | U | U | A | A | A | ||||
| 2 | A | G | G | C | U | U | C | G | G | C | ||||
| 3 | C | U | A | C | G | U | C | C | 
Samples:
AU_label: RNA (28-MER), [U-98% 13C; U-98% 15N]-A,U, 1.5 mM; cobalt hexamine 1.5 mM; sodium chloride 10 mM; sodium phosphate 10 mM
NO_label: RNA (28-MER) 1 mM; cobalt hexamine 1 mM; sodium chloride 10 mM; sodium phosphate 10 mM
AU_label_RDC: RNA (28-MER), [U-98% 13C; U-98% 15N]-A,U, 1.5 mM; cobalt hexamine 1.5 mM; phage 5 mg/mL; sodium chloride 10 mM; sodium phosphate 10 mM
sample_conditions_1: ionic strength: 20 mM; pH: 6; pressure: 1 atm; temperature: 298 K
sample_conditions_2: ionic strength: 20 mM; pH: 6; pressure: 1 bar; temperature: 274 K
Experiments:
| Name | Sample | Sample state | Sample conditions | 
|---|---|---|---|
| 2D 1H-13C HSQC | AU_label | isotropic | sample_conditions_1 | 
| 3D HCCH-TOCSY | AU_label | isotropic | sample_conditions_1 | 
| 2D NOESY13CHSQC | AU_label | isotropic | sample_conditions_1 | 
| 2D HCNTROSY | AU_label | isotropic | sample_conditions_1 | 
| 2D NOESY | AU_label | isotropic | sample_conditions_1 | 
| 2D 1H-13C HSQC | AU_label_RDC | isotropic | sample_conditions_1 | 
| 2D NOESY | NO_label | isotropic | sample_conditions_2 | 
| 2D COSY | NO_label | isotropic | sample_conditions_2 | 
| 2D 1H-13C HSQC | NO_label | isotropic | sample_conditions_1 | 
Software:
SPARKY, Goddard - chemical shift assignment
X-PLOR_NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement
NMR spectrometers:
- Varian VNMRS 500 MHz
 - Agilent INOVA 900 MHz
 - Agilent INOVA 800 MHz
 - Agilent NMR System 600 MHz