BMRB Entry 25785
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR25785
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: NMR Assignment and structure of CssA5 (middle region) of CssA thermometer from Neisseria meningitidis PubMed: 27369378
Deposition date: 2015-08-31 Original release date: 2016-07-26
Authors: Barnwal, Ravi; Godin, Kate; Varani, Gabriele
Citation: Barnwal, Ravi; Loh, Edmund; Godin, Kate; Yip, Jordan; Lavender, Hayley; Tang, Christoph; Varani, Gabriele. "Structure and mechanism of a molecular rheostat, an RNA thermometer that modulates immune evasion by Neisseria meningitidis" Nucleic Acids Res. 44, 9426-9437 (2016).
Assembly members:
CssA5_RNA_(43-MER), polymer, 43 residues, 13741.223 Da.
Natural source: Common Name: b-proteobacteria Taxonomy ID: 487 Superkingdom: Bacteria Kingdom: not available Genus/species: Neisseria meningitidis
Experimental source: Production method: in vitro transcription
Entity Sequences (FASTA):
CssA5_RNA_(43-MER): GGUGAGUACGUAGAGUAUAC
UUCGGUAUACUUAUAUACUU
ACC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 32 |
| 15N chemical shifts | 18 |
| 1H chemical shifts | 204 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | RNA (43-MER) | 1 |
Entities:
Entity 1, RNA (43-MER) 43 residues - 13741.223 Da.
| 1 | G | G | U | G | A | G | U | A | C | G | ||||
| 2 | U | A | G | A | G | U | A | U | A | C | ||||
| 3 | U | U | C | G | G | U | A | U | A | C | ||||
| 4 | U | U | A | U | A | U | A | C | U | U | ||||
| 5 | A | C | C |
Samples:
sample_1: CssA5 RNA (43-MER)0.4 1.1 mM; CssA5 RNA (43-MER), 13C/15N-uniformly labeled, 0.4 1.1 mM; CssA5 RNA (43-MER), 13C/15N-AU labeled, 0.4 1.1 mM; CssA5 RNA (43-MER), partially deuterated, 0.4 1.1 mM; H2O 95%; D2O 5%
sample_conditions_1: pH: 6.0; pressure: 1 atm; temperature: 273 K
Experiments:
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-15N HSQC | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H TOCSY | sample_1 | isotropic | sample_conditions_1 |
| 2D DQF-COSY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 3D 1H-13C NOESY | sample_1 | isotropic | sample_conditions_1 |
| 3D HCCH-TOCSY | sample_1 | isotropic | sample_conditions_1 |
Software:
X-PLOR_NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement, structure solution
TOPSPIN, Bruker Biospin - collection, processing
SPARKY, Goddard - chemical shift assignment, data analysis, peak picking
NMR spectrometers:
- Bruker Avance 800 MHz
- Bruker Avance 600 MHz