BMRB Entry 19387
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR19387
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution structure of an intramolecular (3+1) human telomeric G-quadruplex bound to a telomestatin derivative PubMed: 23909929
Deposition date: 2013-07-24 Original release date: 2013-08-26
Authors: Chung, Wan Jun; Heddi, Brahim; Tera, Masayuki; Iida, Keisuke; Nagasawa, Kazuo; Phan, Anh Tuan
Citation: Chung, Wan Jun; Heddi, Brahim; Tera, Masayuki; Iida, Keisuke; Nagasawa, Kazuo; Phan, Anh Tuan. "Solution structure of an intramolecular (3 + 1) human telomeric g-quadruplex bound to a telomestatin derivative." J. Am. Chem. Soc. 135, 13495-13501 (2013).
Assembly members:
DNA_(5'-D(*TP*TP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*A)-3'), polymer, 24 residues, 7591.945 Da.
entity_L2H, non-polymer, 686.675 Da.
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
DNA_(5'-D(*TP*TP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*A)-3'): TTGGGTTAGGGTTAGGGTTA
GGGA
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 240 |
| 31P chemical shifts | 23 |