BMRB Entry 18336
Click here to enlarge.
            
                PDB ID: 
                
                
                Entry in NMR Restraints Grid
                Validation report in NRG-CING
            Chem Shift validation:  AVS_full
BMRB Entry DOI: doi:10.13018/BMR18336
MolProbity Validation Chart            
                    NMR-STAR file interactive viewer.
                    NMR-STAR v3 text file.
                    NMR-STAR v2.1 text file (deprecated)
                    XML gzip file.
                    RDF gzip file.
                    All files associated with the entry
                
Title: Structure of the RNA claw of the DNA packaging motor of bacteriophage 29 PubMed: 22879380
Deposition date: 2012-03-19 Original release date: 2012-07-30
Authors: Harjes, Elena; Matsuo, Hiroshi; Kitamura, Aya
Citation: Harjes, Elena; Kitamura, Aya; Zhao, Wei; Morais, Marc; Jardine, Paul; Grimes, Shelley; Matsuo, Hiroshi. "Structure of the RNA claw of the DNA packaging motor of bacteriophage 29." Nucleic Acids Res. 40, 9953-9963 (2012).
Assembly members:
RNA_(27-MER), polymer, 27 residues,   8586.186 Da.
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: Phi 29
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
RNA_(27-MER): GGACUUCCAUUGCUUCGGCA
AAAGUCC
- assigned_chemical_shifts
 
| Data type | Count | 
| 13C chemical shifts | 69 | 
| 15N chemical shifts | 9 | 
| 1H chemical shifts | 209 | 
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID | 
|---|---|---|
| 1 | RNA (27-MER) | 1 | 
Entities:
Entity 1, RNA (27-MER) 27 residues - 8586.186 Da.
| 1 | G | G | A | C | U | U | C | C | A | U | ||||
| 2 | U | G | C | U | U | C | G | G | C | A | ||||
| 3 | A | A | A | G | U | C | C | 
Samples:
sample_1: RNA (27-MER), [U-100% 13C; U-100% 15N], 300 uM; H2O 90%; D2O 10%
sample_conditions_1: ionic strength: 50 mM; pH: 6.5; pressure: 1 atm; temperature: 298 K
Experiments:
| Name | Sample | Sample state | Sample conditions | 
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 | 
| 2D 1H-15N HSQC | sample_1 | anisotropic | sample_conditions_1 | 
| 2D 1H-13C HSQC aliphatic | sample_1 | anisotropic | sample_conditions_1 | 
| 2D 1H-13C HSQC aromatic | sample_1 | anisotropic | sample_conditions_1 | 
| 2D DQF-COSY | sample_1 | isotropic | sample_conditions_1 | 
Software:
CNS, Brunger A. T. et.al. - refinement
NMR spectrometers:
- Varian INOVA 800 MHz
 - Varian INOVA 600 MHz
 - Varian INOVA 900 MHz