BMRB Entry 16852
Click here to enlarge.
            
                PDB ID: 
                
                
                Entry in NMR Restraints Grid
                Validation report in NRG-CING
            Chem Shift validation:  AVS_full
BMRB Entry DOI: doi:10.13018/BMR16852
MolProbity Validation Chart            
                    NMR-STAR file interactive viewer.
                    NMR-STAR v3 text file.
                    NMR-STAR v2.1 text file (deprecated)
                    XML gzip file.
                    RDF gzip file.
                    All files associated with the entry
                
Title: Solution structure of a fully modified 2'-F/2'-OMe siRNA construct PubMed: 20624819
Deposition date: 2010-04-09 Original release date: 2010-07-27
Authors: Podbevsek, Peter; Bhat, Balkrishen; Plavec, Janez
Citation: Podbevsek, Peter; Allerson, Charles; Bhat, Balkrishen; Plavec, Janez. "Solution-state structure of a fully alternately 2'-F/2'-OMe modified 42-nt dimeric siRNA construct." Nucleic Acids Res. 38, 7298-7307 (2010).
Assembly members:
ISIS401156, polymer, 21 residues,  Formula weight is not available
ISIS401157, polymer, 21 residues,  Formula weight is not available
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
ISIS401156: XXXXXXXXXXXXXXXXXXXX
X
ISIS401157: XXXXXXXXXXXXXXXXXXXX
X
- assigned_chemical_shifts
 
| Data type | Count | 
| 1H chemical shifts | 231 | 
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID | 
|---|---|---|
| 1 | ISIS401156 | 1 | 
| 2 | ISIS401157 | 2 | 
Entities:
Entity 1, ISIS401156 21 residues - Formula weight is not available
Fully 2' modified GGGUAAAUACAUUCUUCAUUU
| 1 | FG | MG | FG | MU | FOL | MA | FOL | MU | FOL | MC | ||||
| 2 | FOL | MU | FU | MC | FU | MU | FC | MA | FU | MU | ||||
| 3 | FU | 
Entity 2, ISIS401157 21 residues - Formula weight is not available
Fully 2' modified AUGAAGAAUGUAUUUACCCUU
| 1 | MA | FU | MG | FOL | MA | FG | MA | FOL | MU | FG | ||||
| 2 | MU | FOL | MU | FU | MU | FOL | MC | FC | MC | FU | ||||
| 3 | MU | 
Samples:
ISIS_D2O: ISIS401156 2 mM; ISIS401157 2 mM; D2O 100%; NaCl 20 mM; sodium phosphate 20 mM
ISIS_H2O: ISIS401156 2 mM; ISIS401157 2 mM; H2O 100%; NaCl 20 mM; sodium phosphate 20 mM
RT: ionic strength: 20 mM; pH: 6.8; pressure: 1 atm; temperature: 298 K
5C: ionic strength: 20 mM; pH: 6.8; pressure: 1 atm; temperature: 278 K
Experiments:
| Name | Sample | Sample state | Sample conditions | 
|---|---|---|---|
| 2D DQF-COSY | ISIS_D2O | isotropic | RT | 
| 2D 1H-1H NOESY | ISIS_D2O | isotropic | RT | 
| 2D 1H-1H NOESY | ISIS_H2O | isotropic | RT | 
| 2D 1H-1H NOESY | ISIS_D2O | isotropic | 5C | 
| 2D 1H-1H NOESY | ISIS_H2O | isotropic | 5C | 
| 2D HP-COSY | ISIS_D2O | isotropic | RT | 
| 2D 1H-1H NOESY | ISIS_D2O | anisotropic | RT | 
Software:
SPARKY v3.115, Goddard - chemical shift assignment
VNMRJ v2.2C, Varian - collection
AMBER v9, Case, Darden, Cheatham, III, Simmerling, Wang, Duke, Luo, ... and Kollm - structure solution
NMR spectrometers:
- Varian Uniform NMR System 800 MHz
 - Varian Uniform NMR System 600 MHz