BMRB Entry 16485
Click here to enlarge.
            
                PDB ID: 
                
                
                Entry in NMR Restraints Grid
                Validation report in NRG-CING
            Chem Shift validation:  AVS_anomalous, AVS_full, LACS
BMRB Entry DOI: doi:10.13018/BMR16485
MolProbity Validation Chart            
                    NMR-STAR file interactive viewer.
                    NMR-STAR v3 text file.
                    NMR-STAR v2.1 text file (deprecated)
                    XML gzip file.
                    RDF gzip file.
                    All files associated with the entry
                
Title: Solution structure of the THAP zinc finger of THAP1 in complex with its DNA target PubMed: 20144952
Deposition date: 2009-09-08 Original release date: 2010-02-17
Authors: Campagne, Sebastien; Gervais, Virginie; Saurel, Olivier; Milon, Alain
Citation: Campagne, Sebastien; Saurel, Olivier; Gervais, Virginie; Milon, Alain. "Structural determinants of specific DNA-recognition by the THAP zinc finger." Nucleic Acids Res. 38, 3466-3476 (2010).
Assembly members:
THAP_domain, polymer, 87 residues,  Formula weight is not available
RRM1, polymer, 32 residues,  Formula weight is not available
ZN, non-polymer,   65.409 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: recombinant technology Host organism: Escherichia coli
Entity Sequences (FASTA):
THAP_domain: MVQSCSAYGCKNRYDKDKPV
SFHKFPLTRPSLCKEWEAAV
RRKNFKPTKYSSICSEHFTP
DSFKRESNNKLLKENAVPTI
FLELVPR
RRM1: GCTTGTGTGGGCAGCGCGCT
GCCCACACAAGC
- assigned_chemical_shifts
 - RDCs
 - assigned_chemical_shifts
 - heteronucl_NOEs
 - heteronucl_T1_relaxation
 - heteronucl_T2_relaxation
 
| Data type | Count | 
| 13C chemical shifts | 351 | 
| 15N chemical shifts | 84 | 
| 1H chemical shifts | 892 | 
| T1 relaxation values | 73 | 
| T2 relaxation values | 73 | 
| heteronuclear NOE values | 73 | 
| residual dipolar couplings | 53 | 
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID | 
|---|---|---|
| 1 | THAP_domain | 1 | 
| 2 | RRM1 | 2 | 
| 3 | ZN | 3 | 
Entities:
Entity 1, THAP_domain 87 residues - Formula weight is not available
| 1 | MET | VAL | GLN | SER | CYS | SER | ALA | TYR | GLY | CYS | ||||
| 2 | LYS | ASN | ARG | TYR | ASP | LYS | ASP | LYS | PRO | VAL | ||||
| 3 | SER | PHE | HIS | LYS | PHE | PRO | LEU | THR | ARG | PRO | ||||
| 4 | SER | LEU | CYS | LYS | GLU | TRP | GLU | ALA | ALA | VAL | ||||
| 5 | ARG | ARG | LYS | ASN | PHE | LYS | PRO | THR | LYS | TYR | ||||
| 6 | SER | SER | ILE | CYS | SER | GLU | HIS | PHE | THR | PRO | ||||
| 7 | ASP | SER | PHE | LYS | ARG | GLU | SER | ASN | ASN | LYS | ||||
| 8 | LEU | LEU | LYS | GLU | ASN | ALA | VAL | PRO | THR | ILE | ||||
| 9 | PHE | LEU | GLU | LEU | VAL | PRO | ARG | 
Entity 2, RRM1 32 residues - Formula weight is not available
| 1 | DG | DC | DT | DT | DG | DT | DG | DT | DG | DG | ||||
| 2 | DG | DC | DA | DG | DC | DG | DC | DG | DC | DT | ||||
| 3 | DG | DC | DC | DC | DA | DC | DA | DC | DA | DA | ||||
| 4 | DG | DC | 
Entity 3, ZN - Zn - 65.409 Da.
| 1 | ZN | 
Samples:
sample_1: THAP domain, [U-100% 13C; U-100% 15N], 1 mM; RRM1 1 mM; D2O 10%; H2O 90%; NaCl 30 mM
sample_2: THAP domain 1 mM; RRM1 1 mM; D2O 10%; H2O 90%; NaCl 30 mM
sample_conditions_1: ionic strength: 0.03 M; pH: 6.8; pressure: 1 atm; temperature: 296 K
Experiments:
| Name | Sample | Sample state | Sample conditions | 
|---|---|---|---|
| 3D HNCACB | sample_1 | isotropic | sample_conditions_1 | 
| 3D CBCA(CO)NH | sample_1 | isotropic | sample_conditions_1 | 
| 3D HNCO | sample_1 | isotropic | sample_conditions_1 | 
| 3D HCCH-TOCSY | sample_1 | isotropic | sample_conditions_1 | 
| 3D 1H-15N NOESY | sample_1 | isotropic | sample_conditions_1 | 
| 3D 1H-13C NOESY | sample_1 | isotropic | sample_conditions_1 | 
| 3D 1H-15N TOCSY | sample_1 | isotropic | sample_conditions_1 | 
| 3D H(CCO)NH | sample_1 | isotropic | sample_conditions_1 | 
| 2D 1H-1H NOESY | sample_2 | isotropic | sample_conditions_1 | 
| 2D 1H-1H TOCSY | sample_2 | isotropic | sample_conditions_1 | 
| 2D IPAP 15N HSQC | sample_1 | isotropic | sample_conditions_1 | 
| 2D 15N HSQC T1 | sample_1 | isotropic | sample_conditions_1 | 
| 2D 15N HSQC T2 | sample_1 | isotropic | sample_conditions_1 | 
| 2D 15N HSQC Heteronuclear NOE | sample_1 | isotropic | sample_conditions_1 | 
Software:
XEASY, Keller and Wuthrich - chemical shift assignment, data analysis
NMRView, Johnson, One Moon Scientific - data analysis
NMR spectrometers:
- Bruker Avance 950 MHz
 - Bruker Avance 600 MHz
 
Download simulated HSQC data in one of the following formats:
            
CSV: Backbone
            or all simulated shifts
            
SPARKY: Backbone
            or all simulated shifts